CLASS XII

BIOLOGY (044)

SAMPLE PAPER-04

Max. Marks 70                                                                                                                                     Time allowed: 3 hours

General Instructions:

1) There are a total of 26 questions and five sections in the question paper. All the questions are compulsory.

2) Section A contains question number 1 to 5, Very Short Answer type questions of one mark each.

3) Section B contains question number 6 to 10, Short Answer type I questions of two marks each.

4) Section C contains question number 11 to 22, Short Answer type II questions of three marks each.

5) Section D contains question number 23, Value Based question of four marks each.

6) Section E contains question number 24 to 26, Long Answer type questions of five marks each.

7) There is no overall choice, however, internal choices have been provided in one question of two marks, one question of three marks and all three questions of five marks. An examinee has to attempt any one of the questions out of the two given in the question paper with the same question number.

 

SECTION - A

Question 1:

Determine the number of male gametophytes produced by a bilobed dithecous anther having 150 microspore mother cells in each microsporangium.

Question 2:  

Identify the type of chromosomal mutation represented in the figure given below:

Question 3:

State the number of amino acids present in the resulting peptide upon the translation of the following base sequence in the template strand of mRNA:

AUGGUGGAGCUGAAAUUCUAGGCG

Question 4:

Name the causative agent of the disease which causes enormous swelling of various body parts like legs, scrotal sacs, breasts, etc. due to blockage of lymph vessels.

Question 5:

Cite an example of an inverted pyramid  of number.

SECTION - B

Question 6:

Explain why banana is both a true fruit as well as a parthenocarpic fruit.

Question 7:

Genotype Rr was crossed with genotype rr. What would be the genotypic ratio of the progeny? Mention the term used to denote such a kind of cross.

Question 8:

Given below is the schematic representation of the sequence of steps that takes place during the transcription in a eukaryotic cell. Label the parts mention a, b, c and d.

 

Question 9:

Are the tendrils of Cucurbita and thorns of Bougainvillea homologous or analogous? Name the type of evolution which has brought about such a similarity in them.

Question 10:

What are the two beneficial roles played by Lactic acid bacteria (LAB) other than converting milk into curd?

OR

Mention any two important roles that predation plays in nature.

SECTION - C

Question 11:

Give reasons for the following statements:

(i) Failure of the testes to descend into the scrotal sacs results into sterility.

(ii) Oxytocin is referred to as the ‘birth hormone’.

(iii) Amniocentensis is banned in India.

Question 12:

Briefly describe the three ways by which the male gametes present in the pollen tube enter the embryo sac for fertilisation.

Question 13:

(a) Draw a pedigree for the family which has the following as its members:

      Normal father, carrier mother, affected son, normal son, carrier daughter and a normal daughter.

(b) With the help of a Punnette square, predict whether the disease with which the family is affected is Phenylketonuria, if the family can never have an affected daughter. Take the dominant allele as ‘A’ and recessive allele as ‘a’.

Question 14:

What is DNA fingerprinting? Give its any four applications.

OR

What is genetic code? Write any three characteristics of genetic code.

Question 15:

(i) Name the respective form in which the malarial parasite enters into:
(a) Human body and
(b) body of female Anopheles.

(ii) Name the toxin responsible for the appearance of symptoms of malaria in human beings. Why do these symptoms occur periodically?

Question 16:  

(i) Give any three role animal husbandry plays in human welfare.
(ii) Name any three hybrid varieties of crops developed in India.

Question 17:

What are biocontrol agents? Give two examples of organisms which are used as biocontrol agents against mosquitoes.

Question 18:

(i) What does the figure given above depict?
(ii) Which among the following DNA segments (of the sizes given below) will travel more distance and which will travel the least distance?
      A – 460 bp         B – 188 bp      C – 406 bp           D – 233 bp
(iii) Name the compound used to visualize these DNA segments.

Question 19:

Define the following terms and give one example of each:
(i) Mutualism
(ii) Parasitism
(iii) Interspecific competition

Question 20:

Give a schematic representation of a food web in nature.

Question 21:

What are threatened species? Name any three categories of threatened species.

Question 22:

Describe the role of gene therapy in treating SCID.

SECTION - D

Question 23:

A forest which was very saw a rapid decline in its flora and fauna due to habitat destruction and overexploitation of forest resources. The Government decided to declare it as a biohotspot. Due to this declaration, soon in few years the forest regained its species richness. On the other hand the people demarcated a biologically rich portion of the forest as a sacred grove and started worshipping it.

(i) What are the values being promoted by both the cases?

(ii) Suggest a few ways by which one could also contribute to this concern.

(iii) What would have happened if the forest was not declared a biohotspot?

SECTION - E

Question 24:

Describe oogenesis. Give a schematic representation of oogenesis in females mentioning the number of chromosomes at each stage.

OR

(i) Draw a neat and labeled diagram of the internal structure of a mature embryo sac of a flowering plant.
(ii) What is meant by triple fusion? Where and how does it take place? Name the nuclei involved in the fusion.

Question 25:

Draw a labeled schematic sketch of the replication fork of DNA. Also, explain the role of various enzymes involved in DNA replication.

OR

(i) What is Natural selection? Who suggested natural selection as a mechanism of evolution?

(ii) Briefly describe the three types of natural selection with an example of each.

Question 26:

Study the population growth curves in the graph given below, and answer the questions that follow:

(i) Identify the curves ‘a’ and ‘b’.
(ii) Which one of the two is more realistic and why?
(iii) Why is the other growth curve not realistic? Explain.
(iv) Give the equation for the curve ‘b’. Also mention what each term in the equation designate.

OR

Give a detailed account about how genetically engineered insulin was produced using rDNA technology.

**********