CLASS XII

BIOLOGY (044)

SAMPLE PAPER-03

Max. Marks 70                                                                                                                                 Time allowed: 3 hours

General Instructions:

1) There are a total of 26 questions and five sections in the question paper. All the questions are compulsory.

2) Section A contains question number 1 to 5, Very Short Answer type questions of one mark each.

3) Section B contains question number 6 to 10, Short Answer type I questions of two marks each.

4) Section C contains question number 11 to 22, Short Answer type II questions of three marks each.

5) Section D contains question number 23, Value Based question of four marks each.

6) Section E contains question number 24 to 26, Long Answer type questions of five marks each.

7) There is no overall choice, however, internal choices have been provided in one question of two marks, one question of three marks and all three questions of five marks. An examinee has to attempt any one of the questions out of the two given in the question paper with the same question number.

 

SECTION - A

Question 1:

Arrange the following structures in the correct order in which a human sperm travels along the human reproductive tract.

Urethra, Epididymis, Seminiferous tubules, Vasa efferentia, Vas deferens, Ejaculatory duct

Question 2:  

What is the technical term assigned to the type of pollination in which the pollen of a flower gets transferred to the stigma of another flower belonging to the same plant?

Question 3:

Given below is a sequence of one strand of DNA.

           5’ -  GATTCGATTCGATTCGATTCGATTCGATTC – 3’

Write down its complementary sequence in 5’       3’

Question 4:

Calculate the percentage of guanine in a DNA which has 30% thymine.

Question 5:

What is the type of interspecific relationship exhibited by a fig and a wasp?

SECTION - B

Question 6:

Define the following terms:

(i) Parthenocarpy

(ii) Implantation

Question 7:

List down any two pre-requisites of a suitable cloning vector.

Question 8:

Name the causative agent associated with the following diseases:

Sr. No.	Disease	Causative agent
1	Filariasis
2	Malaria
3	Syphilis
4	Typhoid

Question 9:

What is the expanded form of IUCN? Name the document it publishes to maintain the record of taxon facing risk of extinction.

Question 10:

State the Hardy-Weinberg’s Principle. What is its significance?

OR

Give any two embryological evidences of evolution.

SECTION - C

Question 11:

Draw a diagrammatic sketch of microscopic view of a mammalian ovary and label the following parts : primary follicles, Graafian follicle and Corpus luteum.

Question 12:

Give any two significant difference between the following pairs:

 (i) Microsporogenesis and Megasporogenesis

 (ii) Menstrual Cycle and Oestrous Cycle

 (iii) Menarche and Menopause

                                                                  OR

Briefly explain the In vitro fertilisation technique (IVF) which helps a couple to conceive a child. 

Question 13:

While experimenting on the plant Mirabilis jalapa (4 o’clock flower), the scientists found that when a plant bearing red flowers (dominant trait) is crossed with another plant bearing white flowers (recessive trait), the progeny so obtained bears neither red nor white flowers but pink flowers. What could be the possible reason for the deviation of the results from the expected Mendelian outcome?
What is the deviation seen in the ideal phenotypic ratio of the F2 generation so obtained, if the parents taken were homozygous for both the traits? Explain with the help of a cross.

Question 14:

With the help of a Punnett square, explain what is the probability of the offspring to be colourblind, if:

(i) a colourblind man marries a normal woman.

(ii) a carrier woman marries a normal man.

Question 15:

State the contribution of the following scientists:

 (i) Hugo de Vries

(ii) Charles Darwin

(iii) Kary Mullis

Question 16:  

Briefly explain what is meant by Central dogma? Who put forward this concept?

Question 17:

Give the purpose of the following tools and techniques used in the recombinant DNA technology:

(i) PCR

(ii) Gel Electrophoresis

(iii) DNA probes

Question 18:

What is the source and medical significance of the following products obtained from microbes?

PRODUCT	SOURCE	MEDICAL SIGNIFICANCE
1.Streptokinase
2. Cyclosporin A
3. Statins

Question 19:

Draw a labeled diagram of the structure of an antibody molecule.

Question 20:

What is Cancer? Give atleast four possible causes of Cancer?

Question 21:

What is “Rivet Popper Hypothesis”? Who proposed it?

Question 22:

What is meant by in-situ conservation? Briefly explain any two in-situ conservation strategies.

SECTION - D

Question 23:

Ravi and Irfan are very close friends. One day Ravi met with an accident while driving on his way to the market. The accident was a severe one and Ravi got injured badly. He was immediately taken to the hospital. The doctors told his parents that Ravi (whose blood group is O) needs blood transfusion as he has lost a lot of blood while bleeding. Neither of his parents have O blood group. The news was spread and Irfan came to know about it. Luckily, his blood group is also O. But Irfan’s father objects him from donating his blood saying Ravi has ‘different blood’ as he belongs to another community. Do you think Irfan’s father is right? How should Irfan (being a student of biology) convince is his father giving logical reasonsing?

SECTION - E

Question 24:

Explain in detail the formation of a 7-celled and 8-nucleated female gametophyte from a megaspore mother cell (MMC).

                                                                    OR

Describe in detail how Hershey and Chase experimentally proved that DNA is the genetic material and not proteins.

Question 25:

Study the figure given below. Comment and contrast upon the concept of evolution of long neck and forelimbs in giraffes according to Lamarck and Darwin.

                                                                             OR

Given below is a karyotype of a person suffering from a chromosomal disorder.

(i) Identify and name the disorder. Is the disorder related to the autosomes or the sex chromosomes?

(ii) By what other name is this disorder known as and why?

(iii) What is the cause of of this disorder?

(iv) Write at least three symptoms of this disorder.

Question 26:

(i) Name the restriction enzyme employed to get the cut depicted in the figure given above. Explain how did it get its name.

(ii) What is the other name given to the restriction endonucleases and why?

(iii) What is a palindromic sequence? Explain with an example.

(iv) Why are only type II Restriction endonuclease used in genetic engineering?

(v) Name the enzyme used to join the above two segments of DNA.

OR

(i) What is meant by Immunity? Classify its types with the help of a flowchart. Also mention and briefly explain the types of innate/natural immunity.

(ii) Explain the “law of ten per cent”. Who proposed this law?

**********