Daily Practice Problems Molecular Basis of Inheritance

Question 1:

The bond that joins two nucleotides in a DNA strand is:[Level: Moderate]

(a)glycosidic bond

(b)phosphoester bond

(c)phosphodiester bond

(d)hydrogen bonds

Question 2:

The methodology of Sequence Annotation used in Human Genome Project includes sequencing: [Level: Moderate]

(a)only those gene which are expressed as RNAs

(b)only the non-coding genes

(c)both coding and non-coding regions of the genome

(d)repetitive sequences in the DNA.

Question 3:

The percentage composition of guanine in a double stranded DNA is 30%. Find the percentage composition of other nitrogenous bases.[Level: Moderate]

(a)[A] = 20%, [C] = 20%, [T] = 30%

(b)[A] = 30%, [C] = 20%, [T] = 30%

(c)[A] = 20%, [C] = 30%, [T] = 20%

(d)[A] = 30%, [C] = 30%, [T] = 20%

Question 4:

The biochemical nature of the transforming principle was determined by:[Level: Easy]

(a)Griffith

(b)Avery, MacLeod and McCarty

(c)Hershey and Chase

(d)Meselson and Stahl

Question 5:

The Okazaki fragments of lagging strand are joined due to the activity of enzyme:[Level: Easy]

(a)DNA polymerase

(b)DNA ligase

(c)DNA

(d)Primase

Question 6:

Which among the following statements regarding transcription is incorrect?[Level: Difficult]

(a) Transcription begins when sigma factor binds transiently with the RNA polymerase.

(b)RNA polymerase I transcribes hnRNA, the precursor of mRNA in eukaryotes.

(c)RNA polymerase III helps in the transcription of 5S rRNA, tRNA and snRNA.

(d)The termination of transcription occurs when rho factor binds to the RNA polymerase in the terminator region of the transcription unit.

Question 7:

In eukaryotes, the precursor of mRNA is synthesised by:[Level: Moderate]

(a)RNA polymerase I only

(b)RNA polymerase II only

(c)RNA polymerase I and III

(d)RNA polymerase III only

Question 8:

Some viruses can direct the synthesis of DNA from RNA. This process is called:[Level: Moderate]

(a)transcription

(b)replication

(c)translation

(d)reverse transcription

Question 9:

In a transcription unit, the terminator is located at:[Level: Easy]

(a)5’ end of template strand

(b)3’ end of template strand

(d)3’ end of coding strand

Question 10:

Read the statements given below:[Level: Difficult]

I. rRNA serves as a template for protein synthesis.

II. tRNA brings amino acids to the site of protein synthesis and reads the genetic code.

III. RNA polymerase binds to the promoter region and initiates translation.

IV. A segment of DNA coding for protein is called intron.

In the light of above statements, choose the set of statements which are correct.

(a)I and III only

(b)II and III only

(c)Only II

(d)Only IV

Question 11:

Given below is a sequence of nucleotides on the mRNA. Using the sequence, how many amino acids can be polymerised during translation to form a polypeptide chain?[Level: Moderate]

5’ – AUGGUGCCUGGUGGGUUUUCGUUAUGACCA – 3’

(a)7

(b)8

(d)10

Question 12:

The feature of genetic code that indicates that one amino acid can be coded by more than one codon is:[Level: Moderate]

(a)degeneracy

(b)universality

(c)non-ambiguity

(d)collinearity

Question 13:

Read the following statements:[Level: Difficult]

I. DNA mutates at a faster rate than RNA.

II. The 2’-OH group of RNA makes it more labile and easily degradable

III. Transcription and translation in prokaryotes can be coupled as they take place in same compartment.

IV. RNA is a better genetic material for the storage of genetic information.

V. Both DNA and RNA can direct their synthesis due to complementarity of their base pairs.

In the light of above statements, find the set of correct statements from the options given below:

(a) I and III only

(b) II, III and V

(d) I, II, III and IV

Question 14:

The process of removal of introns during post-transcriptional modifications in eukaryotes is called:[Level: Moderate]

(a)Capping

(b)Splicing

(c)Tailing

(d)Initiation

Question 15:

In an mRNA molecule, the untranslated regions are present:[Level: Moderate]
(a) before the start codon

(b) after the start codon

(d) before start codon and after stop codon

Question 16:

Statement I:[Level: Difficult]
Three codons – UAA, UAG and UGG do not code for any amino acid.

Statement II:

AUG has dual functions – codes for methionine and acts a start codon.

With respect to the statements given above, choose the correct answer from the options given below:

(a) Statement I is correct but Statement II is incorrect.

(b) Statement I is incorrect but Statement II is correct.

(d) Both Statement I and Statement II are correct.

Question 17:

Match the items given in Column I to Column II and find the correct answer from the options given below: [Level: Difficult]

Column I					Column II
1. Site of attachment of RNA polymerase					(i) operator gene
2. Transcribes mRNA for protein synthesis					(ii) structural gene
3. Controls the activity of operator gene					(iii) promoter gene
4. Interacts with repressor protein					(iv) regulator gene
	1.	2.	3.	4.
(a)	(iii)	(ii)	(iv)	(i)
(b)	(ii)	(iii)	(iv)	(i)
(c)	(iii)	(ii)	(i)	(iv)
(d)	(ii)	(iii)	(iv)	(i)

Question 18:

The last of the 24 chromosomes to be sequenced under Human Genome Project was:[Level: Moderate]

(a)chromosome 1

(b)chromosome 16

(c)chromosome 11

(d)chromosome 17

Question 19:

The enzyme β-galactosidase in lac operonis coded by: [Level: Easy]

(a)i-gene

(b)y-gene

(c)a-gene

(d)z-gene

Question 20:

The experimental proof for semi-conservative mode of DNA replication was shown in bacterium E.coli by: [Level: Easy]

(a) Sutton and Boveri

(b) Watson and Crick

(d) Hershey and Chase

**********

Problem-solving on NEET Biology Molecular Basis of Inheritance NCERT Chapter 6 after learning a theoretical concept is crucial for several reasons:

Application of Knowledge: Problem-solving allows you to apply the theoretical concepts of the topic NEET Biology Molecular Basis of Inheritance you have learned to real-life situations. It helps you bridge the gap between abstract knowledge and practical scenarios, making the learning more relevant and meaningful.
Understanding Deeper Concepts: When you encounter problems related to a theoretical concept that you learned in NEET Biology Molecular Basis of Inheritance NCERT Chapter 6, you are forced to delve deeper into its intricacies. This deeper understanding enhances your comprehension of the subject and strengthens your grasp of the underlying principles.
Critical Thinking: Problem-solving encourages critical thinking and analytical skills. It requires you to analyze the problem, identify relevant information, and devise a logical solution. This process sharpens your mind and improves your ability to approach complex challenges effectively.
Retention and Recall: Actively engaging in problem-solving reinforces your memory and improves long-term retention. Applying the concepts learned in Molecular Basis of Inheritance NEET Biology in practical scenarios helps you remember them better than passive reading or memorization.
Identifying Knowledge Gaps: When you attempt to solve problems, you may encounter areas where your understanding is lacking. These knowledge gaps become evident during problem-solving, and you can then focus on filling those gaps through further study and practice. You can refer Molecular Basis of Inheritance NEET Biology Notes on LearnoHub.com
Boosting Confidence: Successfully solving problems after learning a theoretical concept boosts your confidence in your abilities to handle Molecular Basis of Inheritance. This confidence motivates you to tackle more challenging tasks and improves your overall performance in the subject.
Preparation for Exams and Challenges: Many exams, especially in science, mathematics, and engineering, involve problem-solving tasks. Regular practice in problem-solving prepares you to face these exams with confidence and perform well. It is also advised to take tests on Molecular Basis of Inheritance NEET Biology Online Tests at LearnoHub.com.
Enhancing Creativity: Problem-solving often requires thinking outside the box and exploring various approaches. This fosters creativity and innovation, enabling you to come up with novel solutions to different problems.
Life Skills Development: Problem-solving is a valuable life skill that extends beyond academics. It equips you with the ability to tackle various challenges you may encounter in personal and professional life.
Improving Decision Making: Problem-solving involves making decisions based on available information and logical reasoning. Practicing problem-solving enhances your decision-making skills, making you more effective in making informed choices.

In summary, problem-solving after learning a theoretical concept on CBSE Molecular Basis of Inheritance NEET Biology is an essential part of the learning process. It enhances your understanding, critical thinking abilities, and retention of knowledge. Moreover, it equips you with valuable skills that are applicable in academic, personal, and professional contexts.

You must have heard of the phrase “Practice makes a man perfect”. Well, not just a man, practice indeed enhances perfection of every individual.

Practicing questions plays a pivotal role in achieving excellence in exams. Just as the adage goes, "Practice makes perfect," dedicating time to solve a diverse range of exam-related questions yields manifold benefits. Firstly, practicing questions allows students to familiarize themselves with the exam format and types of problems they might encounter. This familiarity instills confidence, reducing anxiety and improving performance on the actual exam day. Secondly, continuous practice sharpens problem-solving skills and enhances critical thinking, enabling students to approach complex problems with clarity and efficiency. Thirdly, it aids in identifying weak areas, allowing students to focus their efforts on improving specific topics. Moreover, practice aids in memory retention, as active engagement with the material reinforces learning. Regular practice also hones time management skills, ensuring that students can allocate appropriate time to each question during the exam. Overall, practicing questions not only boosts exam performance but also instills a deeper understanding of the subject matter, fostering a holistic and effective learning experience.

All About Daily Practice Problems on NEET Biology Molecular Basis of Inheritance NCERT Chapter 6

Our Daily Practice Problems (DPPs) offer a diverse range of question types, including Multiple Choice Questions (MCQs) as well as short and long answer types. These questions are categorized into Easy, Moderate, and Difficult levels, allowing students to gradually progress and challenge themselves accordingly. Additionally, comprehensive solutions are provided for each question, available for download in PDF format - Download pdf solutions as well as Download pdf Questions. This approach fosters a holistic learning experience, catering to different learning styles, promoting self-assessment, and improving problem-solving skills. With our well-structured DPPs, students can excel in exams while gaining a deeper understanding of the subject matter. Hope you found the content on NEET Biology Molecular Basis of Inheritance NCERT Chapter 6 useful.

Last but not least, to get the best hold on NEET Biology Molecular Basis of Inheritance NCERT Chapter 6, do not forget to check out:

Molecular Basis of Inheritance NEET Biology Best videos
Molecular Basis of Inheritance NEET Biology NCERT Solutions
NEET Biology Molecular Basis of Inheritance Revision notes
Molecular Basis of Inheritance NEET Biology DPPs, Download PDF of solutions
NEET Biology Molecular Basis of Inheritance Online Tests
NEET Biology Sample papers